PCK1/YKR097W Locus History Help


Nomenclature History
Standard Name Reference
PCK1 Valdes-Hevia MD, et al.  (1989) Isolation and characterization of the gene encoding phosphoenolpyruvate carboxykinase from Saccharomyces cerevisiae. FEBS Lett 258(2):313-6
Sequence Annotation Notes
DateNote
2011-02-03Four nucleotides were inserted within the intergenic region between ORFs YKR096W and PCK1/YKR097W.
New    630504  GCACTTGGGCAGAGCCCCCACCCAGGGCCTTGTCGGAAAAAATCGGAATATCCCACACGA  630563
               |||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||
Old    630146  GCACTTGGGCAGAG-CCCCACCCA-GGCCTTGTCGGAAAAAATCGGAATATCCCACACGA  630203
New    630624  TACATCTCTTTTCTTTTTTTGACTCACAATAGGAAAAAACCGAGCTTCCTTTCATCCGGC  630683
               ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||
Old    630264  TACATCTCTTT-C-TTTTTTGACTCACAATAGGAAAAAACCGAGCTTCCTTTCATCCGGC  630321
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()