GLG1/YKR058W Locus History Help


Nomenclature History
Standard Name Reference
GLG1 Cheng C, et al.  (1995) Requirement of the self-glucosylating initiator proteins Glg1p and Glg2p for glycogen accumulation in Saccharomyces cerevisiae. Mol Cell Biol 15(12):6632-40
Sequence Annotation Notes
DateNote
2008-12-18Data from Nagalakshmi et al. 2008 suggest that there is an in-frame AUG 2 codons upstream of the currently annotated AUG for either all or some of the transcripts of GLG1/YKR058W.

Nagalakshmi U, et al.  (2008) The transcriptional landscape of the yeast genome defined by RNA sequencing. Science 320(5881):1344-9
2005-12-01Based on the automated comparison of related fungi, Cliften et al. (2003) and Brachat et al. (2003) suggest that the start site for GLG1/YKR058W be moved 409 nt upstream. SGD has confirmed the insertion of a G after the G at 522426 and the deletion of the A at 552522. As a consequence, YKR058W was extended at the 5' end, altering the N-terminus and increasing the size the predicted protein from 480 amino acids to 616 amino acids.
New:        GCGTACTAGTGTGATGGGAATGTATAAGAAGCTGGCTATTGCCACATTGCTCTATTCCGC
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Old: 552393 GCGTACTAGTGTGATGGGAATGTATAAGAAGCTG-CTATTGCCACATTGCTCTATTCCGC 552451
and
New:        TAGAGGAAGCAGGCAAAAAA-GGCGACATTGAAACATGC
|||||||||||||||||||| ||||||||||||||||||
Old: 552502 TAGAGGAAGCAGGCAAAAAAAGGCGACATTGAAACATGC 552540
Brachat S, et al.  (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
Cliften P, et al.  (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6