SAP190/YKR028W Locus History Help


Nomenclature History
Standard Name Reference
SAP190 Luke MM, et al.  (1996) The SAP, a new family of proteins, associate and function positively with the SIT4 phosphatase. Mol Cell Biol 16(6):2744-55
Sequence Annotation Notes
DateNote
2011-02-03A single G nucleotide was inserted within the ORF SAP190/YKR028W near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 65 amino acids shorter.
New    497254  ATATCAAGCGATGAAGAAGACTCCGAAGATGAAGATGAAGAGAATGATATGGGCAATGAG  497313
               ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Old    496897  ATATCAAGCGATGAAGAAGACTCCGAA-ATGAAGATGAAGAGAATGATATGGGCAATGAG  496955
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()