MCH2/YKL221W Locus History Help


Nomenclature History
Standard Name Reference
MCH2 Makuc J, et al.  (2001) The putative monocarboxylate permeases of the yeast Saccharomyces cerevisiae do not transport monocarboxylic acids across the plasma membrane. Yeast 18(12):1131-43
Sequence Annotation Notes
DateNote
2011-02-03Nucleotide change(s) in the coding region of MCH2/YKL221W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 342 is now Alanine rather than Arginine.
New    7090    GGCCATGTGGATACCTTGTAAAAATTTGGCCACTGCGATAGCTTTTGGATTATTGGTTGG  7149
               ||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||
Old    7091    GGCCATGTGGATACCTTGTAAAAATTTGGCCACTGCGATACGTTTTGGATTATTGGTTGG  7150
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()