URA1/YKL216W Locus History Help


Nomenclature History
Standard Name Reference
URA1 Link, A. and Olson, M.  (1989) Personal Communication, Mortimer Map Edition 10
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide deletion was made within the intergenic region between ORFs JEN1/YKL217W and URA1/YKL216W.
New    24779   TGAGGTCATTCCCTAACCTTGG-ATCCAAGTCAATCTGGTATCTTCCCACCCTAAATAGT  24837
               |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Old    24779   TGAGGTCATTCCCTAACCTTGGGATCCAAGTCAATCTGGTATCTTCCCACCCTAAATAGT  24838
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
Mapping Notes
DateNote
1989-10-01Edition 10: ura1-trp3 are 105-115 kb from Tel-L and are at least 215 kb from cen11

Mortimer RK, et al.  (1989) Genetic map of Saccharomyces cerevisiae, edition 10. Yeast 5(5):321-403