TOR2/YKL203C Locus History Help


Nomenclature History
Standard Name Reference
TOR2 Hall, M.  (1993) Personal Communication, Mortimer Map Edition 12
Other Name(s)Reference
DRR2 Cafferkey R, et al.  (1993) Dominant missense mutations in a novel yeast protein related to mammalian phosphatidylinositol 3-kinase and VPS34 abrogate rapamycin cytotoxicity. Mol Cell Biol 13(10):6012-23
Sequence Annotation Notes
DateNote
2004-02-13Insertion of three nucleotides was confirmed by sequencing genomic DNA from BY4743 (which is derived from S288C). This is in agreement with GenBank accession X71416, which is the sequence of YKL203C from JK9-3da. Personal communication from Vik Anand (vik@ucla.edu).

New: 58925 CCAAACCCCAGGCAGCGCCGGCAGCCAAAGGCGCCATTGCCTTCTTCACTTCGGGTTTTG 58984
           |||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||
Old: 58925 CCAAACCCCAGGCAGCG---GCAGCCAAAGGCGCCATTGCCTTCTTCACTTCGGGTTTTG 58981
Mapping Notes
DateNote
1994-08-01Edition 12: tor2 has been physically mapped in the region between ste6 and fas1

Mortimer RK, et al.  (1994) "Genetic and Physical maps of Saccharomyces cerevisiae (Edition 12)". Pp. 374-377 in 1994 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America