GFA1/YKL104C Locus History Help


Nomenclature History
Standard Name Reference
GFA1 Watzele G and Tanner W  (1989) Cloning of the glutamine:fructose-6-phosphate amidotransferase gene from yeast. Pheromonal regulation of its transcription. J Biol Chem 264(15):8753-8
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution was made in the intergenic region between ORFs YKL105C and GFA1/YKL104C.
New    243154  AAGGAGAAGTGATAGTAGAAAGACGGATGGGAGGCTGGGGGACGAAGAGAAAGTAAAAGG  243213
               ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Old    242798  AAGGAGAAGTGATTGTAGAAAGACGGATGGGAGGCTGGGGGACGAAGAGAAAGTAAAAGG  242857
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()