YET1/YKL065C Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2006-05-19.
Standard Name Reference
YET1 Toikkanen JH, et al.  (2006) YET1, YET2 and YET3 of Saccharomyces cerevisiae Encode BAP31 Homologs with Partially Overlapping Functions. J. Biol. Sci. (Faisalabad) 6(3):446-456
Sequence Annotation Notes
DateNote
2011-02-03Nucleotide change(s) in the coding region of YET1/YKL065C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 16 is now Methionine rather than Valine.
New    316964  TACGGATCCGGAATGGCAAAGGCAAAACGAAGATGAAGAGCATTACCATCTCAACAGTGA  317023
               |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old    316608  TACGGATCCGGAATGGCAAAGGCAAAACGAAGATGAAGAGCATTACCACCTCAACAGTGA  316667
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()