CSE4/YKL049C Locus History Help


Nomenclature History
Standard Name Reference
CSE4 Stoler S, et al.  (1995) A mutation in CSE4, an essential gene encoding a novel chromatin-associated protein in yeast, causes chromosome nondisjunction and cell cycle arrest at mitosis. Genes Dev 9(5):573-86
Other Name(s)Reference
CSL2 Baker RE, et al.  (1998) Mutations synthetically lethal with cep1 target S. cerevisiae kinetochore components. Genetics 149(1):73-85
Sequence Annotation Notes
DateNote
2001-02-22Note that the systematic sequence for CSE4/YKL049C is shorter than the sequence reported in Genbank entry X71621 (see Genes Dev 1995 Mar 1;9(5):573-86). The systematic sequence has a deleted GC base pair at nucleotide 2419. Note that you can view the longer sequence by retrieving All Associated Seq from the locus page and clicking on the U20327_1.cds link. The sequence change is currently under review by the sequencing coordinator (Bernard Dujon, MIPS) for this chromsome region. (personal communication from Sam Stoler and Judith Sharp 2001-02-22).
2003-01-07Due to the insertion of a G after the G at 346324, the coordinates of CSE4/YKL049C have been changed from 346130-345717 to 346406-345717, extending the ORF from 414 bp in length to 690 bp. This sequence change was verified in FY1679 (S288c derivative strain) background by SGD. Thanks to Sam Stoler, Judith Sharp, Vivian Measday, Sue Biggins, and Kelcy Newell for reporting this sequence error on Chromosome XI to SGD.
Old: 346321 CCTG-AAGCCTGTTGACGTTACTGAGTGATCTTCCACTCGAATCACTTTGAATAGCAGAA 346379
            |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
New: 346320 CCTGGAAGCCTGTTGACGTTACTGAGTGATCTTCCACTCGAATCACTTTGAATAGCAGAA 346379
Stoler S, et al.  (1995) A mutation in CSE4, an essential gene encoding a novel chromatin-associated protein in yeast, causes chromosome nondisjunction and cell cycle arrest at mitosis. Genes Dev 9(5):573-86
2003-01-10The G inserted after the G at 346324 three days ago was changed to a C.
Old: 346321 CTGGAAGCCTGTTGACGTTACTGAGTGATCTTCCACTCGAATCACTTTGAATAGCAGAAC 346380
            ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New: 346321 CTGCAAGCCTGTTGACGTTACTGAGTGATCTTCCACTCGAATCACTTTGAATAGCAGAAC 346380