PHD1/YKL043W Locus History Help


Nomenclature History
Standard Name Reference
PHD1 Gimeno CJ and Fink GR  (1994) Induction of pseudohyphal growth by overexpression of PHD1, a Saccharomyces cerevisiae gene related to transcriptional regulators of fungal development. Mol Cell Biol 14(3):2100-12
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution was made in the intergenic region between ORFs PHD1/YKL043W and SPC42/YKL042W.
New    358244  GCGTCGTGGTTGGTGAACCTGGTACAAAATAAATAAAAAAACACCTGCTAAAAAATATCA  358303
               ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Old    357888  GCGTCGTGGTTGGTGAACCTGGTACAAAATAAATAAAAAAATACCTGCTAAAAAATATCA  357947
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()