VPS24/YKL041W Locus History Help


Nomenclature History
Standard Name Reference
VPS24 Babst M, et al.  (1998) The Vps4p AAA ATPase regulates membrane association of a Vps protein complex required for normal endosome function. EMBO J 17(11):2982-93 Robinson JS, et al.  (1988) Protein sorting in Saccharomyces cerevisiae: isolation of mutants defective in the delivery and processing of multiple vacuolar hydrolases. Mol Cell Biol 8(11):4936-48 Rothman JH, et al.  (1989) Characterization of genes required for protein sorting and vacuolar function in the yeast Saccharomyces cerevisiae. EMBO J 8(7):2057-65
Other Name(s)Reference
DID3 Amerik AY, et al.  (2000) The Doa4 deubiquitinating enzyme is functionally linked to the vacuolar protein-sorting and endocytic pathways. Mol Biol Cell 11(10):3365-80
VPL26 Raymond CK, et al.  (1992) Morphological classification of the yeast vacuolar protein sorting mutants: evidence for a prevacuolar compartment in class E vps mutants. Mol Biol Cell 3(12):1389-402
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide insertion was made in the intergenic region between ORFs SPC42/YKL042W and VPS24/YKL041W.
New    359914  ATCGCTTTTGACGATATAGTACTAGCAATCTGCGGTTCCAATGGAATGGCGTAAACGCAT  359973
               ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Old    359558  ATCGCTTTTGACGATATAGTACTAGCAATCTGCGGTTCCAATGGAAT-GCGTAAACGCAT  359616
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()