RIX1/YHR197W Locus History 
- Summary
- Locus History
- Literature
- Gene Ontology
- Phenotype
- Interactions
- Expression
- Protein
- Wiki
| Nomenclature History | |
|---|---|
| Standard Name | Reference |
| RIX1 | Gadal O, et al. (2001) Nuclear export of 60s ribosomal subunits depends on Xpo1p and requires a nuclear export sequence-containing factor, Nmd3p, that associates with the large subunit protein Rpl10p. Mol Cell Biol 21(10):3405-15 |
| Other Name(s) | Reference |
|---|---|
| IPI2 | Krogan NJ, et al. (2004) High-definition macromolecular composition of yeast RNA-processing complexes. Mol Cell 13(2):225-39 |
| Nomenclature History Notes | |
|---|---|
| Date | Note |
| 2003-06-24 | IPI2 was reserved by Nevan Krogan for this locus for a short time. IPI2=Involved in Processing ITS2. |
| Sequence Annotation Notes | |
|---|---|
| Date | Note |
| 2011-02-03 | A single nucleotide substitution within the coding region of RIX1/YHR197W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 762 is now Glutamic Acid rather than Glycine.
New 496127 GTTTGAAATTCCCGCTATCGAATTAAGTGATGACGAAGAGGAGGAGGAAGAAGAAGAATA 496186
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Old 496127 GTTTGAAATTCCCGCTATCGAATTAAGTGATGACGAAGAGGAGGAGGAAGAAGGAGAATA 496186
|
| Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. () | |
