RIX1/YHR197W Locus History Help


Nomenclature History
Standard Name Reference
RIX1 Gadal O, et al.  (2001) Nuclear export of 60s ribosomal subunits depends on Xpo1p and requires a nuclear export sequence-containing factor, Nmd3p, that associates with the large subunit protein Rpl10p. Mol Cell Biol 21(10):3405-15
Other Name(s)Reference
IPI2 Krogan NJ, et al.  (2004) High-definition macromolecular composition of yeast RNA-processing complexes. Mol Cell 13(2):225-39
Nomenclature History Notes
DateNote
2003-06-24IPI2 was reserved by Nevan Krogan for this locus for a short time. IPI2=Involved in Processing ITS2.
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution within the coding region of RIX1/YHR197W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 762 is now Glutamic Acid rather than Glycine.
New   496127  GTTTGAAATTCCCGCTATCGAATTAAGTGATGACGAAGAGGAGGAGGAAGAAGAAGAATA  496186
              ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Old   496127  GTTTGAAATTCCCGCTATCGAATTAAGTGATGACGAAGAGGAGGAGGAAGAAGGAGAATA  496186
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()