NMD3/YHR170W Locus History Help


Nomenclature History
Standard Name Reference
NMD3 He F and Jacobson A  (1995) Identification of a novel component of the nonsense-mediated mRNA decay pathway by use of an interacting protein screen. Genes Dev 9(4):437-54
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide insertion was made in the intergenic region between NMD3/YHR170W and ATG7/YHR171W.
New    445607  CCGGCACGGCAAAACAAAAAAATTAAGGGAACTCATTATTTTACGATGCTACTTAGATAA  445666
               |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Old    445608  CCGGCACG-CAAAACAAAAAAATTAAGGGAACTCATTATTTTACGATGCTACTTAGATAA  445666
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()