SOL3/YHR163W Locus History Help


Nomenclature History
Standard Name Reference
SOL3 Shen WC, et al.  (1996) Los1p, involved in yeast pre-tRNA splicing, positively regulates members of the SOL gene family. Genetics 143(2):699-712
Sequence Annotation Notes
DateNote
2003-12-01Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for SOL3/YHR163W be moved 93 nt downstream. This suggestion was reviewed by SGD curators, but will not be incorporated until supported by experimental data. The reason(s) for this decision are as follows: Although S. paradoxus and S. mikatae both share the same start methionine, the start codon predicted for S. bayanus is upstream of the proposed conserved start methionine.

Kellis M, et al.  (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
2008-10-28RNA sequencing data from Nagalakshmi et al. 2008 suggest that there is an in-frame AUG 31 codons upstream of the currently annotated AUG for either all or some of the transcripts of SOL3/YHR163W. The upstream AUG represents the previously annotated start for this ORF, the annotation of which was changed based on comparative DNA sequence data from Kellis et al. 2003 and high-throughput identification of transcription start sites by Zhang & Dietrich 2005.

Kellis M, et al.  (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
Zhang Z and Dietrich FS  (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51
Nagalakshmi U, et al.  (2008) The transcriptional landscape of the yeast genome defined by RNA sequencing. Science 320(5881):1344-9
2005-11-07High-throughput identification of transcription start sites by Zhang and Dietrich 2005 confirmed that the start site for YHR163W should be moved 93 nt downstream from 423632 to 423725. As a consequence of this annotation change, YHR163W was shortened at the 5' end, decreasing the size of the predicted protein from 280 amino acids to 249 amino acids.

Kellis M, et al.  (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
Zhang Z and Dietrich FS  (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51
2011-02-03A single nucleotide insertion was made in the intergenic region between ORFs YHR162W and SOL3/YHR163W.
New    423707  CCCTGGTCCGCGACCAAATGGTGACAGTCGGTGTGTTTTCTGAGAGGGCTAGTTTGACCC  423766
               |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Old    423710  CCCTGGTCCGCGAC-AAATGGTGACAGTCGGTGTGTTTTCTGAGAGGGCTAGTTTGACCC  423768
Dietrich F  (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. ()