ECM14/YHR132C Locus History Help


Nomenclature History
Standard Name Reference
ECM14 Lussier M, et al.  (1997) Large scale identification of genes involved in cell surface biosynthesis and architecture in Saccharomyces cerevisiae. Genetics 147(2):435-50
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide insertion and a single nucleotide deletion were made in the intergenic region between ORFs ECM14/YHR132C and IGO2/YHR132W-A.
New    369838  GTCTTTTAAACCGTCGAAAATATTTTATCCTTCCTTCCATTTAGTTGGAACCATTTTCTA  369897
               ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old    369841  GTCTTTTAAACCGTCGAAAATATTTTATCCTTCCTTCCATTTAGTTGGA-CCATTTTCTA  369899
New    369948  TGATCTTTTAAATTACAGGTTATCGCGGGAGAATATT-GGGGTTCAGAAATACAACACAT  370006
               ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Old    369950  TGATCTTTTAAATTACAGGTTATCGCGGGAGAATATTTGGGGTTCAGAAATACAACACAT  370009
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()