YHR095W Feature History Help

Sequence Annotation Notes
DateNote
2011-02-03A single C nucleotide was inserted within ORF YHR095W, near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 20 amino acids longer.
New   293329  TACGTTTTTGCAAGCAAAAATGAAGATAATCCGAGCGCATGCGCAAGTAGTCCCTGCCAT  293388
              ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Old   293332  TACGTTTTTGCAAGCAAAAATGAAGATAATCCGAGCGCATGCG-AAGTAGTCCCTGCCAT  293390
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
2011-02-03A single nucleotide deletion was made in the intergenic region between ORFs YHR095W and HXT5/YHR096C.
New    294409  ATCCTACTTAAAATAAAGAAAAAAAA-CAAAAACGTCATGATGATTTTGATATTATTAGA  294467
               |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Old    294411  ATCCTACTTAAAATAAAGAAAAAAAAACAAAAACGTCATGATGATTTTGATATTATTAGA  294470
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()