HSE1/YHL002W Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2002-08-04.
Standard Name Reference
HSE1 Bilodeau PS, et al.  (2002) The Vps27p Hse1p complex binds ubiquitin and mediates endosomal protein sorting. Nat Cell Biol 4(7):534-9
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide insertion was made in the intergenic region between ORFs LAG1/YHL003C and HSE1/YHL002W.
New    102540  ATTCTAACTGTTAAATATAGGGGCCATGCCAGAGGCAATGCGTAAATCTATCTAAGGAAA  102599
               ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Old    102536  ATTCTAACTGTTAAATATAGGGGCCATGC-AGAGGCAATGCGTAAATCTATCTAAGGAAA  102594
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()