GLC7/YER133W Locus History Help


Nomenclature History
Standard Name Reference
GLC7 Peng ZY, et al.  (1990) Purification and characterization of glycogen synthase from a glycogen-deficient strain of Saccharomyces cerevisiae. J Biol Chem 265(23):13871-7
Other Name(s)Reference
CID1 Neigeborn L and Carlson M  (1987) Mutations causing constitutive invertase synthesis in yeast: genetic interactions with snf mutations. Genetics 115(2):247-53
DIS2 Ohkura H, et al.  (1989) The fission yeast dis2+ gene required for chromosome disjoining encodes one of two putative type 1 protein phosphatases. Cell 57(6):997-1007
DIS2S1 Feng ZH, et al.  (1991) The yeast GLC7 gene required for glycogen accumulation encodes a type 1 protein phosphatase. J Biol Chem 266(35):23796-801 Clotet J, et al.  (1991) The gene DIS2S1 is essential in Saccharomyces cerevisiae and is involved in glycogen phosphorylase activation. Curr Genet 19(5):339-42
PP1 Chen MX, et al.  (1992) Polymerase chain reactions using Saccharomyces, Drosophila and human DNA predict a large family of protein serine/threonine phosphatases. FEBS Lett 306(1):54-8
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution was made in the intergenic region between GLC7/YER133W and tH(GUG)E2.
New    434281  CAATTTTTCTTTATTTTCTTTTATTACTATTATCATTACTATTATTATTAGTATTATTAT  434340
               ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    434277  CAATTTTCCTTTATTTTCTTTTATTACTATTATCATTACTATTATTATTAGTATTATTAT  434336
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()