RPS24A/YER074W Locus History Help


Nomenclature History
Standard Name Reference
RPS24A SGD  (2007) Information without a citation in SGD ()
Other Name(s)Reference
S24A Planta RJ and Mager WH  (1998) The list of cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Yeast 14(5):471-7
S24e Jenner L, et al.  (2012) Crystal structure of the 80S yeast ribosome. Curr Opin Struct Biol 22(6):759-67
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide insertion and several different substitutions were made in the intergenic region between ORFs ALD5/YER073W and RPS24A/YER074W.
New    305701  CAAAAAAAAAAAAACAAAACAAAAAAATAATAACGTGATAAACATTAATGAACAATGTAT  305760
               ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Old    305698  CAAAAAAAAAAAA-CAAAACAAAAAAATAATAACGTGATAAACATTAATGAACAATGTAT  305756
New    305821  TATTGTATATTGAAATATATAGTAATCAAATTCGTTTCATTGATCAAATTGCTCACTAGT  305880
               ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Old    305817  TATTGTATATTAAAATATATAGTAATCAAATTCGTTTCATTGATCAAATTGCTCACTAGT  305876
New    305881  TCTGTTTTTCAAAATTTCATCTTTATAGGTAGATACAAGTGCCAGAGAGATATATAAACA  305940
               ||| ||||  ||||||||||||||||||||||||||||||||||||||||||||||||||
Old    305877  TCTTTTTTCAAAAATTTCATCTTTATAGGTAGATACAAGTGCCAGAGAGATATATAAACA  305936
New    305941  GAAAACTCTATCGATGTGATAATGTATGCCAATATCGGGACTGTACACCCACACATTTAC  306000
               ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Old    305937  GAAAACTCTATCGATGTGATAATGTATGCCATTATCGGGACTGTACACCCACACATTTAC  305996
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
Mapping Notes
DateNote
1997-10-20Edition 14: The name RPS24A previously refered to YJL190C, which is now called RPS22A and encodes ribosomal protein S22A

Cherry JM, et al.  (1997) Genetic and physical maps of Saccharomyces cerevisiae. Nature 387(6632 Suppl):67-73