FCY2/YER056C Locus History Help


Nomenclature History
Standard Name Reference
FCY2 Weber, E.  (1989) Personal Communication, Mortimer Map Edition 10
Other Name(s)Reference
BRA7 Guetsova ML, et al.  (1997) The isolation and characterization of Saccharomyces cerevisiae mutants that constitutively express purine biosynthetic genes. Genetics 147(2):383-97
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide insertion was made in the intergenic region between ORFs FCY2/YER056C and RPL34A/YER056C-A.
New    268801  AACTTGGTTGAAAGTGGCTGAATTTACGACGTAATCTGTCTTGACATCTTTTTTTTTTTCAGCGAGCATT  268870
               |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old    268800  AACTTGGTTGAAAGTGGCTGAATTTACGACGTAATCTGTCTTGACATCTTTTTTTTTT-CAGCGAGCATT  268868
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
Mapping Notes
DateNote
1989-10-01Edition 10: fcy2 is < 1cM distal to his1

Mortimer RK, et al.  (1989) Genetic map of Saccharomyces cerevisiae, edition 10. Yeast 5(5):321-403