ADH7/YCR105W Locus History Help


Nomenclature History
Standard Name Reference
ADH7 SGD  (2007) Information without a citation in SGD ()
Sequence Annotation Notes
DateNote
2000-09-13The systematic sequence was updated in the region between ORFs YCR104W and YCR105W. Note that coordinates listed are chromosomal coordinates.
Old:   307321 TTTCGTCTCCTGTTATACGAATATTTGCATTTCTGTGCCTACTTATGTGTGTATATGTTT 307380
              || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   308596 TT-CGTCTCCTGTTATACGAATATTTGCATTTCTGTGCCTACTTATGTGTGTATATGTTT 308654
2000-09-13The systematic sequence was updated in the region between ORFs YCR105W and YCR106W. Note that coordinates listed below are chromosomal coordinates.
Old:   309301 ATCATGCTTTTGCTTCGAAATCTAGAGTCCGAGCATGTCTGATGAGGTCCTCTTAAAGCA 309360
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
New:   310575 ATCATGCTTTTACTTCGAAATCTAGAGTCCGAGCATGTCTGATGAGGTCCTCTTAAAGCA 310634