KIN82/YCR091W Locus History Help


Nomenclature History
Standard Name Reference
KIN82 Wilson C, et al.  (1992) A putative serine/threonine protein kinase gene on chromosome III of Saccharomyces cerevisiae. Yeast 8(1):71-7
Other Name(s)Reference
FPK2 Nakano K, et al.  (2008) Protein kinases Fpk1p and Fpk2p are novel regulators of phospholipid asymmetry. Mol Biol Cell 19(4):1783-97
Sequence Annotation Notes
DateNote
2000-09-13The systematic sequence was updated in the region encompassing ORF YCR091W, causing a frameshift leading to a C-terminally altered and shortened protein from aa 690 onward. The coding region of YCR091W had been annotated as 2181 nt long, but is now 2163 nt. Note that coordinates listed below are chromosomal coordinates.
Old:   274089 TCAATCCTTCGAAAAAATTAGACTACTTGGCCAAGGTGACGTAGGTAAAGTGTATTTAGT 274148
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
New:   275359 TCAATCCTTCGAAAAAATTAGACTACTTGGCCAAGGTGACGTAGGTAAAGTGTATTTAAT 275418
Old:   275169 TATCTTAACCTACTCTGAAAATTATAC-TACGGAAAAATTCTATACAAAGCAACTTGTAC 275227
              ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
New:   276439 TATCTTAACCTACTCTGAAAATTATACCTACGGAAAAATTCTATACAAAGCAACTTGTAC 276498
2011-02-03A single nucleotide substitution in the coding region of KIN82/YCR091W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 341 is now Valine rather than Methionine.
New    275400  GGTGACGTAGGTAAAGTGTATTTAGTGAGGGAACGCGATACCAACCAGATATTCGCCCTG  275459
               |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Old    275397  GGTGACGTAGGTAAAGTGTATTTAATGAGGGAACGCGATACCAACCAGATATTCGCCCTG  275456
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()