SRB8/YCR081W Locus History Help


Nomenclature History
Standard Name Reference
SRB8 Hengartner CJ, et al.  (1995) Association of an activator with an RNA polymerase II holoenzyme. Genes Dev 9(8):897-910
Other Name(s)Reference
GIG1 Balciunas D and Ronne H  (1995) Three subunits of the RNA polymerase II mediator complex are involved in glucose repression. Nucleic Acids Res 23(21):4421-5
MED12 Bourbon HM, et al.  (2004) A unified nomenclature for protein subunits of mediator complexes linking transcriptional regulators to RNA polymerase II. Mol Cell 14(5):553-7
NUT6 Tabtiang RK and Herskowitz I  (1998) Nuclear proteins Nut1p and Nut2p cooperate to negatively regulate a Swi4p-dependent lacZ reporter gene in Saccharomyces cerevisiae. Mol Cell Biol 18(8):4707-18
Sequence Annotation Notes
DateNote
1998-07-24YCR080W was originally annotated as an independent ORF, but upon further review was merged with neighboring ORF YCR081W. As a result, the annotated start site of YCR081W was moved 603 nt upstream, increasing the coding region of YCR081W in length from 3681 nt to 4284 nt.
1997-07-27Two single nucleotide insertions were made in Chromosome III within the ORF YCR080W to correct the systematic reference sequence: An A was inserted after the G at chromosomal coordinate 253494, and another A was inserted after the G at 253510.
New:   253473 AAACGTGGTTGCATGAATTGAGATTCGTCTCACACTTCGACTGGTCAAAATTGGCAAGTT 253532
              |||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||
Old:   253473 AAACGTGGTTGCATGAATTGAG-TTCGTCTCACACTTCG-CTGGTCAAAATTGGCAAGTT 253530
One single nucleotide substitution was made in the region between ORFs YCR080W and YCR081W: the C at 253651 was changed to G.
New:   253653 GAAAAAGAAGAGGTCAAATGCTGCTGGGGCAGATGATGCCATTTCCATGCACCTGCTAAA 253712
               |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old:   253651 CAAAAAGAAGAGGTCAAATGCTGCTGGGGCAGATGATGCCATTTCCATGCACCTGCTAAA 253710
1998-02-26Two single nucleotide deletions were made in the systematic sequence within ORF YCR080W: The A at chromosomal coordinate 253495 was removed, as was the A at 253512.
Old:   253472 GAAACGTGGTTGCATGAATTGAGATTCGTCTCACACTTCGACTGGTCAAAATTGGCAAGT 253531
              ||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||
New:   253472 GAAACGTGGTTGCATGAATTGAG-TTCGTCTCACACTTCG-CTGGTCAAAATTGGCAAGT 253529
One single nucleotide substitution was made in the region between ORFs YCR080W and YCR081W: The G at 253653 was changed to C.
Old:   253652 AGAAAAAGAAGAGGTCAAATGCTGCTGGGGCAGATGATGCCATTTCCATGCACCTGCTAA 253711
              | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   253650 ACAAAAAGAAGAGGTCAAATGCTGCTGGGGCAGATGATGCCATTTCCATGCACCTGCTAA 253709
Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
Mapping Notes
DateNote
1997-10-20Edition 14: SRB8 has also been called ARE2, but should not be confused with ARE2 on chromosome XIV encoding an acyl-CoA cholesterol acyltransferase

Cherry JM, et al.  (1997) Genetic and physical maps of Saccharomyces cerevisiae. Nature 387(6632 Suppl):67-73