SED4/YCR067C Locus History Help


Nomenclature History
Standard Name Reference
SED4 Hardwick KG, et al.  (1992) Genes that allow yeast cells to grow in the absence of the HDEL receptor. EMBO J 11(11):4187-95
Sequence Annotation Notes
DateNote
2000-09-13The systematic sequence was updated in the region between ORFs YCR067C and YCR068W. Note that coordinates listed below are chromosomal coordinates.
Old:   235399 AATCGTAAATACATAGGCTGGGC-ATATACACTAACATGTGTCGTGACCAATGTGCAGCA 235457
              ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
New:   236665 AATCGTAAATACATAGGCTGGGCCATATACACTAACATGTGTCGTGACCAATGTGCAGCA 236724
Old:   235458 GATAGACTTGCTCATTAAATATATTCCAGGTAGGATTCTCTAAGGGTTTTTTTTTTTTCT 235517
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
New:   236725 GATAGACTTGCTCATTAAATATATTCCAGGTAGGATTCTCTAAGGGTTTTTTTTTTT-CT 236783