BUD31/YCR063W Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2001-08-13.
Standard Name Reference
BUD31 Ni L and Snyder M  (2001) A genomic study of the bipolar bud site selection pattern in Saccharomyces cerevisiae. Mol Biol Cell 12(7):2147-70
Other Name(s)Reference
CWC14 Ohi MD, et al.  (2002) Proteomics analysis reveals stable multiprotein complexes in both fission and budding yeasts containing Myb-related Cdc5p/Cef1p, novel pre-mRNA splicing factors, and snRNAs. Mol Cell Biol 22(7):2011-24
Sequence Annotation Notes
DateNote
2000-09-13The systematic sequence was updated in the region between ORFs YCR063W and YCR065W. Note that coordinates listed are chromosomal coordinates.
Old:   227780 AATCAAAAAATTACTTCTTCTCCTCC-TTACGGTGCCCTTTGATCCTTCTCAAACTTTAA 227838
              |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
New:   229048 AATCAAAAAATTACTTCTTCTCCTCCCTTACGGTGCCCTTTGATCCTTCTCAAACTTTAA 229107