PHO87/YCR037C Locus History Help


Nomenclature History
Standard Name Reference
PHO87 SGD  (2007) Information without a citation in SGD ()
Sequence Annotation Notes
DateNote
2000-09-13The systematic sequence was updated within ORF YCR037C. Note that coordinates listed are chromosomal coordinates.
Old:   195027 GTAAAGATTTATTATTGTCTGTTTTAATAATGATTTTTTCTGAGATTTAATGTTAAATTG 195086
              ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
New:   196290 GTAAAGATTTATTATTGTCTGTTTTAATAATGACTTTTTCTGAGATTTAATGTTAAATTG 196349
Old:   195687 TCTTCTTTTCGATGGAGATGGTTCTCCTGCAGCTATGTTGCTTTCTATATCAGCGATTGG 195746
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
New:   196950 TCTTCTTTTCGATGAAGATGGTTCTCCTGCAGCTATGTTGCTTTCTATATCAGCGATTGG 197009
2000-09-13The systematic sequence was updated in the region between ORFs YCR037C and YCR038C. Coordinates listed are chromosomal coordinates.
Old:   195987 GTGTGAAACACTGTTTTCTGGTAATAATTTTTCAATGCATCGGATTACCTTTCCCACGTG 196046
              |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
New:   197250 GTGTGAAACACTGTTTTCTGGTAATAATTTTTCAATGCATCGGATTACTTTTCCCACGTG 197309
Old:   196227 AAAAAATATTATCTACTGTAGTTATGCAAGTATTCTTAACTTTCAGTACTAAACATGAAT 196286
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
New:   197490 AAAAAATATTATCTACTGTAGTTATGCAAGTATTCTTAATTTTCAGTACTAAACATGAAT 197549