RPS14A/YCR031C Locus History Help


Nomenclature History
Standard Name Reference
RPS14A SGD  (2007) Information without a citation in SGD ()
Other Name(s)Reference
CRY1 Larkin JC and Woolford JL Jr  (1983) Molecular cloning and analysis of the CRY1 gene: a yeast ribosomal protein gene. Nucleic Acids Res 11(2):403-20 Himmelfarb HJ, et al.  (1984) Molecular cloning and biosynthetic regulation of cry1 gene of Saccharomyces cerevisiae. Mol Gen Genet 195(3):500-6
rp59A Planta RJ and Mager WH  (1998) The list of cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Yeast 14(5):471-7
S11 Jenner L, et al.  (2012) Crystal structure of the 80S yeast ribosome. Curr Opin Struct Biol 22(6):759-67
S14A Planta RJ and Mager WH  (1998) The list of cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Yeast 14(5):471-7
Sequence Annotation Notes
DateNote
2000-09-13The systematic sequence was updated within ORF YCR031C. Note that coordinates listed are chromosomal coordinates.
Old:   176367 TTCTAGTACCACCGGTAGCTCTGATCTTAACGTGAACGGCAGTGATACCGACTTCCCTAC 176426
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
New:   177635 TTCTAGTACCACCGGTAGCTCTGATCTTAACGTGAACGGCAGTGATACCGACTTCCTTAC 177694
Old:   176427 ACTTAGCGGCAACATCTTGGGCAGCTAACATAGCAGCGTATGGAGAAGATTCATCTCTGT 176486
              ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
New:   177695 ACTTAGCGGCAACATCTTGGGCAGCCAACATAGCAGCGTATGGAGAAGATTCATCTCTGT 177754
Old:   176727 TTTTCCATCGAAAAAAAAGTTGACAAAATATACTGCCATTGACACAATAGGCTCTACTAA 176786	
              |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
New:   177995 TTTTCCATCGAAAAAAAAGTTGACAAAATATACTGCCATTGACACAATAGGCTCAACTAA 178054
2000-09-13The systematic sequence was updated in the region between features YCR030C and YCR031C. Coordinates listed are chromosomal coordinates.
Old:   175528 CGCTGGTATTCATGTAGAGCACCAACCTGACTGTGAATGCGTAACGTGAAACATGATAGC 175587
              ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||
New:   176795 CGCTGGTATTCATGTAGAGCACCAACCTGACTGTGAATGCGTAAGCTGAAACATGATAGC 176854
Old:   175708 GCCTCCTTCAAAAAAAA-TTTACATATATAACATAGGTGGAAAAACTTCCCTCCGATGTC 175766
              ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
New:   176975 GCCTCCTTCAAAAAAAAATTTACATATATAACATAGGTGGAAAAACTTCCCTCCGATGTC 177034
Old:   176007 CGATTTTGCAACTCTTGGTAATTGTGTCCTTACATTTCCGTAGTGACGTTAATCAAATCG 176066
              |||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||
New:   177275 CGATTTTGTAACTCTTGGTAATTGTGTCCTTACATTTCCGTAATGACGTTAATCAAATCG 177334
Old:   176067 CAATCTTGAATCTTCTTAACTAAAAGGTTATAAGGGCTTTTTTTTATTACTAAATTAACG 176126
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
New:   177335 CAATCTTGAATCTTCTTAACTAAAAGGTTATAAGGGCTTTTTTTTATTACTAAATTGACG 177394
2000-09-13The systematic sequence was updated in the region between features RPS14A/YCR031C and snR189. Note that coordinates listed are chromosomal coordinates.
Old:   176967 CTCTCCTTGGGTTTAAAATAGAATCTTCATTAAAAAAAGTGCTTTCTGTAATATATAGTG 177026	
              ||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||
New:   178235 CTCTCCTTGGGTTTAAAATAGAATCTTCATTAAAAA--GTGCTTTCTGTAATATATAGTG 178292

Old:   177087 CCAGGAAGCGGGATGGTCTGCCGCAAGCAGACAAATTTGCCAAAATGCAGTAGAGAATGG 177146
              |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   178353 CCAGGAGGCGGGATGGTCTGCCGCAAGCAGACAAATTTGCCAAAATGCAGTAGAGAATGG 178412

Old:   177147 CAATGCTCGTGCTGAAGGTTAAAAAAAGAACGCAAAAAAAAAAAGAGTAGTAAAATGTAC 177206
              ||||||||||||||||||| ||||||||||||||||||||||  ||||||||||||||||
New:   178413 CAATGCTCGTGCTGAAGGTGAAAAAAAGAACGCAAAAAAAAA--GAGTAGTAAAATGTAC 178470