FEN2/YCR028C Locus History Help


Nomenclature History
Standard Name Reference
FEN2 SGD  (2007) Information without a citation in SGD ()
Sequence Annotation Notes
DateNote
2000-09-13The systematic sequence was updated within ORF YCR028C. Note that coordinates listed are chromosomal coordinates.
Old:   169861 CACCATGCGTTAACGGCCCCTGAAAACATATTCATTGAAGCAAGAACGATAGCACGTTCT 169920
              ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
New:   171164 CACCATGCGTTAACGGCCCCTGAAAACATATTCATGGAAGCAAGAACGATAGCACGTTCT 171223
Old:   170221 AATGCAAATGTAGAATTAGATGCGAAACCCAAATTCTCACCTCCCAGAACCCAAACAAGA 170280
              |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
New:   171524 AATGCAAATGTAGAATTAGATGCGAAACCCAAGTTCTCACCTCCCAGAACCCAAACAAGA 171583
Old:   170281 GAGAACATCCACCAGTGCCACCTTTTTAGGACTCTAGGAATAGTCGACCAGTCTAACCGG 170340
              |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
New:   171584 GAGAACATCCACCAGTGCCACCTTTTTAAGACTCTAGGAATAGTCGACCAGTCTAACCGG 171643
Old:   170761 CCCAAGGTCAATAAACCCCAGGCAAACGTACAAAAACTTAGCCATATCCTAGGTGGAACA 170820
              |||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||
New:   172064 CCCAAGGTCAATAAACCCCAAGCAAACGTACAAAAACTTAGCCATATCCTGGGCGGAACA 172123
Old:   170881 TTAGACACGGTCAAATCGTTTCCGACCATCTTAAGATCTTCCTTCATACCCGATATATAT 170940
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
New:   172184 TTAGACACGGTCAAATCGTTTCCGACCATCTTAAGATCTTCCTTCATACCGGATATATAT 172243
Old:   171001 AGCACAAACAAGTCTATTTTAAACAGAAGTAATCTCTTTTTAATGGCACGTTTGGAAGAA 171060
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
New:   172304 AGCACAAACAAGTCTATTTTAAACAGAAGTAATCTCTTTTTAATGGCACGCTTGGAAGAA 172363
2000-09-13The systematic sequence was updated in the region between features YCR028C and YCR028C-A. Note that coordinates listed are chromosomal coordinates.
Old:   171301 CCTTTCAAGATCGATTACTCAAAATCTACAATAATCGGACTGCATGGATCAATGGAGGTG 171360
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
New:   172604 CCTTTCAAGATCGACTACTCAAAATCTACAATAATCGGACTGCATGGATCAATGGAGGTG 172663
Old:   171361 TAGCCAATTTTGTAACAATGAAGGATATGTTAAATTCGCTAAAGCTTCCTCCTCTTTTGC 171420
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   172664 TAGGCAATTTTGTAACAATGAAGGATATGTTAAATTCGCTAAAGCTTCCTCCTCTTTTGC 172723
Old:   171481 TATACATTCTATTTGAGAATAAGCATAGTTTTTACATAACTAGTTCGTTATTCCAAATGT 171540
              |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
New:   172784 TATACATTCTATTTGAGAATAAGCATAGTTTT-ACATAACTAGTTCGTTATTCCAAATGT 172842
Old:   171661 TTCTTGGCCCTCAGCATTTTCTTGGCCCTCAGCATT 171696

New:   172962 ------------------------------------ 172962