YCR025C Feature History Help

Sequence Annotation Notes
DateNote
1997-07-27A single nucleotide substitution was made in Chromosome III within the intergenic region between ORFs YCR024C-A and YCR025C to correct the systematic reference sequence: The A at chromosomal coordinate 163256 was changed to G.
New:   163234 TTTTACTCTGTTGGAAATGCGAGAATTGTTTTGATTTTACCCGATTGCGACCTATTCCCG 163293
              |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Old:   163234 TTTTACTCTGTTGGAAATGCGAAAATTGTTTTGATTTTACCCGATTGCGACCTATTCCCG 163293
1998-02-26A single nucleotide substitution was made in the systematic sequence in the intergenic region between ORFs YCR024C-A and YCR025C. The G at chromosomal coordinate 163259 was changed to A. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   163236 ATTTTACTCTGTTGGAAATGCGAGAATTGTTTTGATTTTACCCGATTGCGACCTATTCCC 163295
              ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
New:   163233 ATTTTACTCTGTTGGAAATGCGAAAATTGTTTTGATTTTACCCGATTGCGACCTATTCCC 163292
2000-09-13The systematic sequence was updated within ORF YCR025C. Note that coordinates listed are chromosomal coordinates.
Old:   163401 TGGGATGCTAGGGGAAGTGCGCGCGGATACCGAATCGGCCATCGAACCGGCCACCCGGAT 163460
              |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   163685 TGGGATTCTAGGGGAAGTGCGCGCGGATACCGAATCGGCCATCGAACCGGCCACCCGGAT 163744
Old:   163461 TGAGGTTGGTATGTTGCCTCTTTGCGCAATTTTATTGAATGCAAAGTTTCTCCTTCTAGT 163520
              |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   163745 TGAGTTTGGTATGTTGCCTCTTTGCGCAATTTTATTGAATGCAAAGTTTCTCCTTCTAGT 163804
Old:   163521 AAAAGACAACAGCTGAAAAATGCTCGATGTCCAAATGACGACATAAACCTCCTCGTTTAG 163580
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   163805 AAAGGACAACAGCTGAAAAATGCTCGATGTCCAAATGACGACATAAACCTCCTCGTTTAG 163864
2000-09-13The systematic sequence was updated in the intergenic region between features YCR025C and YCR026C. Note that coordinates listed are chromosomal coordinates.
Old:   163761 GCGCGGGACTCACAAGGATGCGTCTTTTATTTCATAACGCAGTTGTCCCACCTTAAGCTT 163820
              |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
New:   164045 GCGCGGGACTCACAAGGATGCGTCTTTTATTTCATAACGCGGTTGTCCCACCTTAAGCTT 164104