PGK1/YCR012W Locus History Help


Nomenclature History
Standard Name Reference
PGK1 SGD  (2007) Information without a citation in SGD ()
Sequence Annotation Notes
DateNote
2000-09-13The systematic sequence was updated in the intergenic region between features YCR011C and YCR012W. Note that coordinates listed are chromosomal coordinates.
Old:   136571 TTAGATTCCTGACTTCAACTCAAGACGCACAGATATTATAACATCTGCACAATAGGCATT 136630
              ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
New:   136966 TTAGATTCCTGACTTCAACTCAAGACGCACAGATATTATAACATCTGCATAATAGGCATT 137025
2000-09-13The systematic sequence was updated within ORF YCR012W. Note that coordinates listed are chromosomal coordinates.
Old:   137591 GAATTGCAATCATTGTTGGGTAAGGATGTCACCTTCTTGAACGACTGTGTGCGTCCAGAA 137650
              ||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||
New:   137986 GAATTGCAATCATTGTTGGGTAAGGATGTCACCTTCTTGAACGACTGTGTCGGTCCAGAA 138045