YCL076W Feature History Help

Sequence Annotation Notes
DateNote
2000-09-13A single nucleotide insertion was made in the systematic sequence in the region encompassing overlapping features ARS300, YCLWTy5-1, and YCL076W. A single C was inserted after the T at 1435. This change resulted in the predicted protein encoded by YCL076W being elongated at the N-terminal end by 51 amino acids. Note that coordinates listed are chromosomal coordinates.
Old:    1434 CT-AGAGCAATGCTTCTGAGAACATAATCAATCTATCTAGCCCCAACAATTATAAACAGT 1492
             || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:    1441 CTCAGAGCAATGCTTCTGAGAACATAATCAATCTATCTAGCCCCAACAATTATAAACAGT 1500