YCL074W Feature History Help

Sequence Annotation Notes
DateNote
2000-09-13Five single nucleotide substitutions were made in the systematic sequence in the region encompassing pseudogene YCL074W. Note that coordinates listed are chromosomal coordinates.
Old:    3053 GGTCCCATCTACATTGGCGTATACGTAGACGACTTACTTGTTGCTGCTCCCTCTCCTAAA 3112
             |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
New:    3061 GGTCCCATCTACATTGCCGTATACGTAGACGACTTACTTGTTGCTGCTCCCTCTCCTAAA 3120
Old:    3173 GTTGACAAATTCCTCGGTCTTAACATTCATCAATCGACAAACGGAGACATCACTCTCTCC 3232
             |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
New:    3181 GTTGACAAATTCCTCGGTCTTAACATTCATCAATCGTCAAACGGAGACATCACTCTCTCC 3240
Old:    3533 TATCGCTCTGGATCTCAGGTGGCATTAACTGTATATTGTGATGCATCTCATGGAGCTATT 3592
             ||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||
New:    3541 TATCGTTCTGGATCTCAGTTGGCATTAACTGTATATTGTGATGCATCTCATGGAGCTATT 3600
Old:    3593 CACGATCTCCCACACTCTACTGGGGGGTACGTGACTCTACTTGCTGGTGCTCCCGTTACG 3652
             |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
New:    3601 CACGATCTACCACACTCTACTGGGGGGTACGTGACTCTACTTGCTGGTGCTCCCGTTACG 3660
2000-09-13A single nucleotide substitution was made in the systematic sequence in the intergenic region between features YCL074W and YCLWomega2. The C at 3858 was changed to A. Note that coordinates listed are chromosomal coordinates.
Old:    3833 CATCCTGTATTTCACACGAGAGCAACACACATTGCTTTGAGATACCACAAGCTAAGAAAT 3892
             ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
New:    3841 CATCCTGTATTTCACACGAGAGCAAAACACATTGCTTTGAGATACCACAAGCTAAGAAAT 3900