VBA3/YCL069W Locus History Help


Nomenclature History
Standard Name Reference
VBA3 Shimazu M, et al.  (2005) A family of basic amino acid transporters of the vacuolar membrane from Saccharomyces cerevisiae. J Biol Chem 280(6):4851-7
Sequence Annotation Notes
DateNote
2003-12-01Based on the automated comparison of related fungi, Brachat et al. suggest that the N-terminus of YCL069Wp be extended 124 amino acids. This suggestion was reviewed by SGD curators, but will not be incorporated until supported by experimental data. The reason(s) for this decision are as follows: this proposal would require a sequence change and all potential sequence changes must be confirmed in S288C before being incorporated in SGD. However, the proposal from Brachat et al. is supported by the following lines of evidence: this N-terminal extension is also conserved in S. paradoxus.

Brachat S, et al.  (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
2000-09-13Several sequence changes were made in the systematic sequence in the intergenic region between ORFs YCL073C and YCL069W. Note that coordinates listed are chromosomal coordinates.
Old:    8298 CCAACAACACTAGAACTCATCCGATAATTTATTTACTTGATTATTCTTTTTTTTTTTTTT 8357
             |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
New:    8307 CCAACAACACTAGAACTCATCCGATAATTTATTTACTTGATTATTCCTTTTTTTTTTTTT 8366
Old:    8358 TTTCTCTTTCCAGTCCATAAAACTATTTTACTTTTCTTATTTATGTAAATAGTATTTAAGA 8418
             |||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||
New:    8367 TCTCTTT--CCAGTCCATAAAACTATTTTACTTTTCTTATTTATGTAAATAGTATTTAAGA 8425
Old:    8476 ATATATACTTTTACTGACACCTTTCGTCACTATTTTTTGTTTAACCTTTTTTTTGGAAG 8534
             ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
New:    8483 ATATATACTTTTACTGACACCTTTCGTCACTATTTTTTGTTTAACTTTTTTTTTGGAAG 8541
Old:    8535 CACTAAAATTATATGCTCGTAATTATTGAGCATCAAAAAAAATAAAAAAAA--- 8585
              ||||||||||||||||||||||||||||||||||||||||| ||||||||
New:    8542 TACTAAAATTATATGCTCGTAATTATTGAGTATCAAAAAAAAAAAAAAAAAAAA 8595
Old:    8640 ACTTTGACCTGTCGTCGTACAATCAACTTAGTTTCTGAAAATCCACAACGAACCAGTTAT 8699
             ||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||
New:    8650 ACTTTGACCTGTCGTCGTACAATCAACTTAGTTTCCGAAAATCCACGACGAACCAGTTAT 8709
Old:    8700 ACCGAAGACTTTTGTACGACAAGAATACTGTACTGTCGAAACTATCTCTTTTCAAACTGA 8759
             ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
New:    8710 ACCGAAGACTTTTGTACGACAAGAATACTGTACCGTCGAAACTATCTCTTTTCAAACTGA 8769
Old:    8760 TGAGCGAAGCTTGTGTTTATGTCTGTTGAAACAAGGAAAAAAATGCGGTGCCTGTCGACA 8819
             |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:    8770 TGAGTGAAGCTTGTGTTTATGTCTGTTGAAACAAGGAAAAAAATGCGGTGCCTGTCGACA 8829