HMLALPHA2/YCL067C Locus History Help


Nomenclature History
Standard Name Reference
HMLALPHA2 SGD  (2007) Information without a citation in SGD ()
Sequence Annotation Notes
DateNote
2000-09-13A dinucleotide insertion was made in the systematic sequence in the intergenic region between ORFs YCL068C and YCL067C. An AT was inserted after the T at 12340. Note that coordinates listed are chromosomal coordinates.
Old:   12300 TTGATTGTTTATGTATTTTTGCGAAATATATATATATATAT--TCTACACAGATATATAC 12357
             |||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||
New:   12309 TTGATTGTTTATGTATTTTTGCGAAATATATATATATATATATTCTACACAGATATATAC 12368