PBN1/YCL052C Locus History Help


Nomenclature History
Standard Name Reference
PBN1 Naik RR and Jones EW  (1998) The PBN1 gene of Saccharomyces cerevisiae: an essential gene that is required for the post-translational processing of the protease B precursor. Genetics 149(3):1277-92
Sequence Annotation Notes
DateNote
2000-09-13Four single nucleotide insertions were made in the systematic sequence in the intergenic region between ORFs YCL052C and YCL051W. Note that coordinates listed are chromosomal coordinates.
Old:   35450 TGATCTTTTTTATCAGGGGGATCTTCAAAGAAAGGAACTTTTTTTAGGAAAAAAAAA-TA 35508
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
New:   35467 TGATCTTTTTTATCAGGGGGATCTTCAAAGAAAGGAACTTTTTTTAGGAAAAAAAAAATA 35526
Old:   35569 -GT-CTGCTGT-AGTGTGTCCTCCAATACTCTTGCACGACAAAGTTTTAGTTATCCCCTT 35625
              || ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
New:   35587 AGTTCTGCTGTTAGTGTGTCCTCCAATACTCTTGCACGACAAAGTTTTAGTTATCCCCTT 35646