GLK1/YCL040W Locus History Help


Nomenclature History
Standard Name Reference
GLK1 Bisson LF and Fraenkel DG  (1983) Involvement of kinases in glucose and fructose uptake by Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 80(6):1730-4
Other Name(s)Reference
HOR3 Hirayama T, et al.  (1995) Cloning and characterization of seven cDNAs for hyperosmolarity-responsive (HOR) genes of Saccharomyces cerevisiae. Mol Gen Genet 249(2):127-38
Sequence Annotation Notes
DateNote
1997-07-27Several changes were made within the intergenic region between ORFs YCL040W and YCL039W to correct the systematic reference sequence:
New:   52494 CGGGCCTTTGGTTTTTAAGGGAAAATGAAGAACAATAAATGTCTTGCTAGGTCTTCCTTT 52553
             ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Old:   52496 CGGGCCTTTGGTTTTTAAGGGAAAATGAAGAACAATAAATGCCTTGCTAGGTCTTCCTTT 52555
New:   52554 ATCATTTTCC-AACTCAAATATGAAAAGCAGCTCCAAGGGG-CGTACTACTTCAACTAAT 52611
             ||||||||   || ||||||||||||| ||  ||||||||| ||||||||||||||||||
Old:   52556 ATCATTTTTGGAAGTCAAATATGAAAAACACTTCCAAGGGGGCGTACTACTTCAACTAAT 52615
1998-02-26Five separate substitutions and one single nucleotide insertion were made in the systematic sequence in the intergenic region between ORFs YCL040W and YCL039W. The T at chromosomal coordinate 52435 was changed to C, the CC at 52562 was changed to TGG, the C at 52566 was changed to G, the G at 52580 was changed to A, the GC at 52583 was changed to CT, and a G was inserted after the G at 52593. Note that these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   52494 CGGGCCTTTGGTTTTTAAGGGAAAATGAAGAACAATAAATGTCTTGCTAGGTCTTCCTTT 52553
             ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
New:   52496 CGGGCCTTTGGTTTTTAAGGGAAAATGAAGAACAATAAATGCCTTGCTAGGTCTTCCTTT 52555
Old:   52554 ATCATTTTCC-AACTCAAATATGAAAAGCAGCTCCAAGGGG-CGTACTACTTCAACTAAT 52611
             ||||||||   || ||||||||||||| ||  ||||||||| ||||||||||||||||||
New:   52556 ATCATTTTTGGAAGTCAAATATGAAAAACACTTCCAAGGGGGCGTACTACTTCAACTAAT 52615
Mapping Notes
DateNote
1998-11-10Edition 15: GLK1 has also been called YCL312

Cherry JM, et al.  (1998) "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 15)". Pp. 414-420 in 1998 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America
2012-08-21The section of Chromosome III spanning YCL024W to YCL051W and the region of Chromosome IV spanning YDR507C to YDR528W represent paralogous segments that arose from the whole genome duplication. These regions contain the following pairs of paralogous genes:
YCL024W/KCC4 and YDR507C/GIN4
YCL025C/AGP1 and YDR508C/GNP1
YCL035C/GRX1 and YDR513W/GRX2
YCL036W/GFD2 and YDR514C
YCL037C/SRO9 and YDR515W/SLF1
YCL040W/GLK1 and YDR516C/EMI2
YCL043C/PDI1 and YDR518W/EUG1
YCL048W/SPS22 and YDR522C/SPS2
YCL048W-A and YDR524C-B
YCL050C/APA1 and YDR530C/APA2
YCL051W/LRE1 and YDR528W/HLR1

Byrne KP and Wolfe KH  (2005) The Yeast Gene Order Browser: combining curated homology and syntenic context reveals gene fate in polyploid species. Genome Res 15(10):1456-61