BIK1/YCL029C Locus History Help


Nomenclature History
Standard Name Reference
BIK1 Trueheart J, et al.  (1987) Two genes required for cell fusion during yeast conjugation: evidence for a pheromone-induced surface protein. Mol Cell Biol 7(7):2316-28
Other Name(s)Reference
PAC14 Geiser JR, et al.  (1997) Saccharomyces cerevisiae genes required in the absence of the CIN8-encoded spindle motor act in functionally diverse mitotic pathways. Mol Biol Cell 8(6):1035-50
Sequence Annotation Notes
DateNote
2000-09-13Three sequence changes were made in the systematic sequence in the region encompassing ORF YCL029C. Note that coordinates listed are chromosomal coordinates.
Old:   69613 AGCGGTTCCATCGTCGTTCTTCTCGAGGTTTGCGATATCGATGCCTTCTCGATCAATGAT 69672
             ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
New:   69641 AGCGGTTCCATTGTCGTTCTTCTCGAGGTTTGCGATATCGATGCCTTCTCGATCAATGAT 69700
Old:   69673 GCGACTTTTTGCAACTGGATAAATAGTCCACTTTGAGGATACTCTGTTTGAAAATACTTC 69732
             ||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||
New:   69701 GCGACTTTTTGCAACTGAATAAATAGTCCACTTTGAGGATACTCCGTTTGAAAATACTTC 69760
Mapping Notes
DateNote
1992-10-01Edition 11: bik1 has been physically mapped adjacent and proximal to his4

Mortimer RK, et al.  (1992) Genetic and physical maps of Saccharomyces cerevisiae, Edition 11. Yeast 8(10):817-902