AGP1/YCL025C Locus History Help


Nomenclature History
Standard Name Reference
AGP1 Schreve JL, et al.  (1998) The Saccharomyces cerevisiae YCC5 (YCL025c) gene encodes an amino acid permease, Agp1, which transports asparagine and glutamine. J Bacteriol 180(9):2556-9
Other Name(s)Reference
YCC5 Schreve JL, et al.  (1998) The Saccharomyces cerevisiae YCC5 (YCL025c) gene encodes an amino acid permease, Agp1, which transports asparagine and glutamine. J Bacteriol 180(9):2556-9
Nomenclature History Notes
DateNote
2014-04-29The MUP2 genetic locus is likely to represent an allele of AGP1.

Iraqui I, et al.  (1999) Amino acid signaling in Saccharomyces cerevisiae: a permease-like sensor of external amino acids and F-Box protein Grr1p are required for transcriptional induction of the AGP1 gene, which encodes a broad-specificity amino acid permease. Mol Cell Biol 19(2):989-1001
Sequence Annotation Notes
DateNote
2000-09-13The stop site of ORF YCL025C was moved 114 nt upstream, changing the relative coding coordinates from 1-1902 to 1-1788. Chromosomal coordinates change from 77886-75985 to 77918-76131.
2000-09-13Several sequence changes were made in the systematic sequence in the intergenic region between features YCL026C-A and YCL025C. Note that coordinates listed are chromosomal coordinates.
Old:   75487 AATTGAAAAATTATTCGGAAGAGCATTAACAAATATTGATTAATAATCAAGTAACACTCG 75546
             ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
New:   75519 AATTGAAAAATTATTCGGAAGAGCATTGACAAATATTGATTAATAATCAAGTAACACTCG 75578
Old:   75787 TTTTTCTCTCACTTCATATTATTTCACTTATATTTTCCTCTCCATTTCCATCACGCAATC 75846
             |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
New:   75819 TTTTTCTCTCACTTCATATTATTTCACTTATATTTTCCTCTCCACTTCCATCACGCAATC 75878
Old:   75967 GAAGTAAATGCTTTTTTTTT-AACACCAGAAGGCAACGACCCTTTTCCAATAAGGTCCGT 76025
             |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
New:   75999 GAAGTAAATGCTTTTTTTTTTAACACCAGAAGGCAACGACCCTTTTCCAATAAGGTCCGT 76058
Old:   76086 GTCTATGAGAATCTAGGTCGATCTTGTCGGCCCTGATGAACAGTTTCCAATCCTTGTGCC 76145
             ||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||
New:   76119 GTCTATGAGAATCTAGGTCGATCTTGTCT-CCCTGATGAACAGTTTCCAATCCTTGTGCC 76177
2000-09-13Five sequence changes were made in the systematic sequence in the region encompassing ORF YCL025C. Note that coordinates listed are chromosomal coordinates.
Old:   76146 AGACCTTGTAGCCGACATATAGTGCAATCAAGATTGGCATAGCCAAGTAGTTTTCGAAAA 76205
             ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
New:   76178 AGACCTTGTAGCCGACATAAAGTGCAATCAAGATTGGCATAGCCAAGTAGTTTTCGAAAA 76237
Old:   76926 TCACTAATGTTGCAACAACACCTTTAAATCTGTCAATGGCATGTTTACCATTGAAAGCGC 76985
             |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
New:   76958 TCACTAATGTTGCAGCAACACCTTTAAATCTGTCAATGGCATGTTTACCATTGAAAGCGC 77017
Old:   77286 CAAACCCAAAAACCATCATCCACAAGGAAACTGGG-TATGCATTGTAGCCACCAGTCAAG 77344
             ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||
New:   77318 CAAACCCAAAA-CCATCATCCACAAGGAAACTGGGGTATGCATTGTAGCCACCAGTCAAG 77376
Old:   77465 CCGACCAGTAACCCAGTACCGATACCCGTACCCAACGCAATCATCAGAACATGTCTAGGC 77524
             ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   77497 CCGACCAATAACCCAGTACCGATACCCGTACCCAACGCAATCATCAGAACATGTCTAGGC 77556
2000-09-13Several sequence changes were made in the systematic sequence in the intergenic region between features YCL025C and YCL023C. Note that coordinates listed are chromosomal coordinates.
Old:   78005 AACAAATGAGTATTACGAGGAAA-TAACAAAA-GAAACTAATCACGAAGGATATGAGTCT 78062
             ||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||
New:   78037 AACAAATGAGTATTACGAGGAAAATAACAAAAAGAAACTAATCACGAAGGATATGAGTCT 78096
Old:   78363 CATCAACGGCAAAGTTGCAGCTTTTTGCAGCAGATCACTG--GCTTAGACGGCACCCTCA 78420
             ||||||||||||||||||||||||||||||||||||| ||  ||||||||||||||||||
New:   78397 CATCAACGGCAAAGTTGCAGCTTTTTGCAGCAGATCAGTGCCGCTTAGACGGCACCCTCA 78456
2006-01-12SGD confirmed the sequence error predicted by the work of Brachat et al and Schreve et al., and has updated the systematic sequence accordingly. As a consequence of this sequence change, AGP1/YCL025C was extended on the 3' end, altering the C-terminus and increasing the size of the predicted protein from 595 to 633 amino acids
New: 76137 CGATCTTGTCTGCCCTGATGAACAGTTTCCAATCCTTGTGCCAG 76180
           ||||||||||| ||||||||||||||||||||||||||||||||
Old: 76137 CGATCTTGTCT-CCCTGATGAACAGTTTCCAATCCTTGTGCCAG 76179
Schreve JL, et al.  (1998) The Saccharomyces cerevisiae YCC5 (YCL025c) gene encodes an amino acid permease, Agp1, which transports asparagine and glutamine. J Bacteriol 180(9):2556-9
Brachat S, et al.  (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
Mapping Notes
DateNote
2012-08-21The section of Chromosome III spanning YCL024W to YCL051W and the region of Chromosome IV spanning YDR507C to YDR528W represent paralogous segments that arose from the whole genome duplication. These regions contain the following pairs of paralogous genes:
YCL024W/KCC4 and YDR507C/GIN4
YCL025C/AGP1 and YDR508C/GNP1
YCL035C/GRX1 and YDR513W/GRX2
YCL036W/GFD2 and YDR514C
YCL037C/SRO9 and YDR515W/SLF1
YCL040W/GLK1 and YDR516C/EMI2
YCL043C/PDI1 and YDR518W/EUG1
YCL048W/SPS22 and YDR522C/SPS2
YCL048W-A and YDR524C-B
YCL050C/APA1 and YDR530C/APA2
YCL051W/LRE1 and YDR528W/HLR1

Byrne KP and Wolfe KH  (2005) The Yeast Gene Order Browser: combining curated homology and syntenic context reveals gene fate in polyploid species. Genome Res 15(10):1456-61