YCL019W Feature History Help

Sequence Annotation Notes
DateNote
2000-09-13Several sequence changes were made in the systematic sequence in the region encompassing overlapping features YCL019W and YCL020W. Note that coordinates listed are chromosomal coordinates.
Old:   85213 CACCACACACTTTAACATCAGATGAAAACTTTTCTACATGGGTTAAATTTTACATCAGAT 85272
             |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
New:   85600 CACCACACACTTTAACATCAGAAGAAAACTTTTCTACATGGGTTAAATTTTACATCAGAT 85659
Old:   86053 AATGACGAACTACCTGATCACCTTCTTATTGATTCAGGACGTTCGCAAACGCTTGTCAGA 86112
             |||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||
New:   86440 AATGACGAACTACCTGATCACCTTCTTATTGATTCAGGAGCTTCGCAAACGCTTGTCAGA 86499
Old:   86293 GAGCTGGCTAATCAAAATATTACAGCCTGCTTTACCAGAAACACTTTAGAAAGATCGGAT 86352
             ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
New:   86680 GAGCTGGCTAATCAAAATATTACTGCCTGCTTTACCAGAAACACTTTAGAAAGATCGGAT 86739
2000-09-13Several sequence changes were made in the systematic sequence in the region encompassing feature YCL019W. Note that coordinates listed are chromosomal coordinates.
Old:   86593 AACGCATGCACATATCAATGTCCTGACTGTCTAATCGGCAAAAGCACGAAACATAGACAT 86652
             |||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   86980 AACGCTAGCACATATCAATGTCCTGACTGTCTAATCGGCAAAAGCACGAAACATAGACAT 87039
Old:   87133 GTCTCACCAAAAAACGATAAATCCGCCGCAAGACAACATGCAGGTTTAGCTGGACTGGAC 87192
             ||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||
New:   87520 GTCTCACCAAAAAACGATAAATCCGC---AAGACAACATGCAGGTTTAGCTGGACTGGAC 87576
Old:   89413 AGATTTGACTTACTATACTACATCAACACA-TTGCTCAACCATATACTATTCCCCTCTAG 89471
             |||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||
New:   89797 AGATTTGACTTACTATACTACATCAACACACTTGCTCAAC-ATATACTATTCCCCTCTAG 89855
Old:   89712 AGCAGAAATACACGCGGTCAGTGAAGCTATTCCGCTATTGAATAACCTCAGTCACCTTGT 89771
             ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
New:   90096 AGCAGAAATACACGCAGTCAGTGAAGCTATTCCGCTATTGAATAACCTCAGTCACCTTGT 90155
Other Notes
DateNote
2000-08-17Gag processing produces capsid proteins. Pol is cleaved to produce protease, reverse transcriptase and integrase activities.