DCC1/YCL016C Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2001-06-19.
Standard Name Reference
DCC1 SGD  (2007) Information without a citation in SGD ()
Sequence Annotation Notes
DateNote
2000-09-13A sequence change was made in the systematic sequence in the region encompassing feature YCL016C, and the start of YCL016C was moved 213 nt upstream, extending the protein N-terminally by 71 amino acids. Note that coordinates listed are chromosomal coordinates.
Old:   95171 AGAACTGTGTTTGAATGTTTGCGCTGCTTGCAGCACCCAAGTCTTGTCGTGCGAACACAG 95230
             ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
New:   95554 AGAACTGTGTTTGAATGTTTGCGCTGCTT-CAGCACCCAAGTCTTGTCGTGCGAACACAG 95612