SGF29/YCL010C Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2002-09-25.
Standard Name Reference
SGF29 Sanders SL, et al.  (2002) Proteomics of the eukaryotic transcription machinery: identification of proteins associated with components of yeast TFIID by multidimensional mass spectrometry. Mol Cell Biol 22(13):4723-38
Sequence Annotation Notes
DateNote
2000-12-01The stop site of YCL010C was moved 339 nt upstream, increasing the size of the coding region from 441 nt to 780 nt. The chromosomal coordinates have changed from 103995-103515 to 104345-103566.
1997-07-27Four single nucleotide changes were made within the intergenic region between ORFs YCL011C and YCL010C to correct the systematic reference sequence: A T was inserted after chromosomal coordinate 103074, the T at chromosomal coordinate 103519 was removed, as was the C at 103531, and the G at 103543.
New:   103072 TTTTCAATTTTTTTCACCTTCAAGTGAATACATCACTTCCGACGATACCAAAATAATGAC 103131
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old:   103072 TTT-CAATTTTTTTCACCTTCAAGTGAATACATCACTTCCGACGATACCAAAATAATGAC 103130
New:   103492 TGTACCATCTGCTACGACTTTGAGTACT-CACACTGTATC-ATTCGCCGTCG-CACTGCC 103548
              |||||||||||||||||||||||||||| ||||||||||| ||||||||||| |||||||
Old:   103491 TGTACCATCTGCTACGACTTTGAGTACTTCACACTGTATCCATTCGCCGTCGGCACTGCC 103550
1998-02-26Four single nucleotide changes were made in the systematic sequence in the intergenic region between ORFs YCL011C and YCL010C. A single T was deleted at chromosomal coordinate 103071, a single T was inserted after the T at chromosomal coordinate 103515, a C was inserted after the C at 103526, and a G was inserted after the G at 103537. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of some made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   103068 TTTTCAATTTTTTTCACCTTCAAGTGAATACATCACTTCCGACGATACCAAAATAATGAC 103127
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   103072 TTT-CAATTTTTTTCACCTTCAAGTGAATACATCACTTCCGACGATACCAAAATAATGAC 103130
Old:   103488 TGTACCATCTGCTACGACTTTGAGTACT-CACACTGTATC-ATTCGCCGTCG-CACTGCC 103544
              |||||||||||||||||||||||||||| ||||||||||| ||||||||||| |||||||
New:   103491 TGTACCATCTGCTACGACTTTGAGTACTTCACACTGTATCCATTCGCCGTCGGCACTGCC 103550
1998-02-26One single nucleotide substitution was made in the systematic sequence in the region encompassing ORF YCL010C. The C at chromosomal coordinate 104254 was changed to G. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   104205 GCAAGGCCGAGAGACTAACCTAACCAGGTGGTAGTTGGGAAATGTCGACCATTTCGCTGA 104264
              ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
New:   104211 GCAAGGCCGAGAGACTAACCTAACCAGGTGGTAGTTGGGAAATGTCGACGATTTCGCTGA 104270
2000-09-13The systematic sequence was updated within ORF YCL009C. Note that coordinates listed are chromosomal coordinates.
Old:   104408 TTTGCAGACAATTCCACAATACAGCTTGTTTCGCTGATGTCGACGACACGACCTCCAAAG 104467
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
New:   104792 TTTGCAGACAACTCCACAATACAGCTTGTTTCGCTGATGTCGACGACACGACCTCCAAAG 104851