APE3/YBR286W Locus History Help


Nomenclature History
Standard Name Reference
APE3 SGD  (2007) Information without a citation in SGD ()
Sequence Annotation Notes
DateNote
2003-12-01Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for APE3/YBR286W be moved 78 nt downstream. This suggestion was reviewed by SGD curators, but will not be incorporated until supported by experimental data. The reason(s) for this decision are as follows: 1) The sequence analysis is inconclusive because S. mikatae is predicted to use a different start methionine.

Kellis M, et al.  (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
2005-11-07After consultation with MIPS, SGD will incorporate the annotation change suggested by Kellis et al. 2003 for APE3/YBR286W. The start site is being moved 78 nt downstream from chromosomal coordinate 774618 to 774696, resulting in a predicted protein of 537 aa, as opposed to the previously annotated 563 aa. The 1692-nt ORF is now 1614 nt.

Kellis M, et al.  (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
2011-02-03A single nucleotide substitution was made in the intergenic region between ORFs YBR285W and APE3/YBR286W.
New    774401  CTTATCGTCAGAAAGAGTGTTCTCTATGTTTTTGTGCTTCCATAAATATATAGTTCAAAA  774460
               ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Old    774397  CTTATCGTCAGAAAGAGTGTTCTCTATGTTTTTCTGCTTCCATAAATATATAGTTCAAAA  774456
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()