YBR285W Feature History Help

Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution within the coding region of YBR285W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 55 is now Aspartic Acid rather than Histidine.
New    774041  CTTAGAAAGCCCCACTGACGATAGCATGGAGGCGGACATTTCAGATAGAGAAATGGCTAC  774100
               ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Old    774037  CTTAGAAAGCCCCACTGACGATAGCATGGAGGCGGACATTTCACATAGAGAAATGGCTAC  774096
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
2011-02-03A single nucleotide substitution was made in the intergenic region between ORFs YBR285W and APE3/YBR286W.
New    774401  CTTATCGTCAGAAAGAGTGTTCTCTATGTTTTTGTGCTTCCATAAATATATAGTTCAAAA  774460
               ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Old    774397  CTTATCGTCAGAAAGAGTGTTCTCTATGTTTTTCTGCTTCCATAAATATATAGTTCAAAA  774456
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()