REI1/YBR267W Locus History Help


Nomenclature History
Standard Name Reference
REI1 Iwase M and Toh-E A  (2004) Ybr267w is a new cytoplasmic protein belonging to the mitotic signaling network of Saccharomyces cerevisiae. Cell Struct Funct 29(1):1-15
Sequence Annotation Notes
DateNote
1999-04-26Two changes were made to the systematic sequence of Chromosome II within the ORF REI1/YBR267W. The G at chromosomal coordinate 739866 was deleted, and the A at 739912 was deleted; as a result, the start of YBR267W was moved 294 nt upstream.
Note that the deletion at 739912 also affects the overlapping ORF SLM6/YBR266C; as a result, the stop of YBR266C was moved 111 nt upstream:
Old: 739860 GAGCAGGCGGGCCCACATGAAGTCCGATTGGCATCGCTACAATTTGAAAAGAACGTGTTG 739919
            |||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||
New: 739860 GAGCAG-CGGGCCCACATGAAGTCCGATTGGCATCGCTACAATTTGAAAAGA-CGTGTTG 739917
2011-02-03Nucleotide substitutions within the coding regions of overlapping genes REI1/YBR267W and SLM6/YBR266C resulted in altered sequences for both proteins. The start, stop, and reading frames of both proteins remain the same, but protein residues 152-153 of REI1/YBR267W are now KL rather than NV, and protein residue 31 of SLM6/YBR266C is now Serine rather than Threonine.
New    740262  AGGAAGAAATGGCGGAAAGAGTAATGCAAGAAAAGCTACGCAACAGAGTCGATATTCCAC  740321
               ||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||
Old    740257  AGGAAGAAATGGCGGAAAGAGTAATGCAAGAAAACGTACGCAACAGAGTCGATATTCCAC  740316
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()