LDH1/YBR204C Locus History Help


Nomenclature History
Standard Name Reference
LDH1 Thoms S, et al.  (2011) The putative Saccharomyces cerevisiae hydrolase Ldh1p is localized to lipid droplets. Eukaryot Cell 10(6):770-5
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution within the coding region of YBR204C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 63 is now Valine rather than Glutamic Acid.
New    633163  CCTTATTCTTGAATTTCGATCCGATAGTTGTACATTAAAAAACTCCTCATGTTCTGCGAT  633222
               ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Old    633158  CCTTATTCTTGAATTTCGATCCGATAGTTGTTCATTAAAAAACTCCTCATGTTCTGCGAT  633217
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()