MCM7/YBR202W Locus History Help


Nomenclature History
Standard Name Reference
MCM7 Kearsey SE, et al.  (1996) Cell cycle control of eukaryotic DNA replication. Curr Opin Genet Dev 6(2):208-14
Other Name(s)Reference
CDC47 Moir D, et al.  (1982) Cold-sensitive cell-division-cycle mutants of yeast: isolation, properties, and pseudoreversion studies. Genetics 100(4):547-63
Nomenclature History Notes
DateNote
2007-09-14The standard gene name of ORF YBR202W was changed from CDC47 to its current alias MCM7.

Kearsey SE, et al.  (1996) Cell cycle control of eukaryotic DNA replication. Curr Opin Genet Dev 6(2):208-14
Moir D, et al.  (1982) Cold-sensitive cell-division-cycle mutants of yeast: isolation, properties, and pseudoreversion studies. Genetics 100(4):547-63
Sequence Annotation Notes
DateNote
2011-02-03Nucleotide changes within the coding region of MCM7/YBR202W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 552-558 is now GINTTLN rather than VINTNPG, and residue 574 is now Tyrosine rather than Isoleucine.
New    627403  AACAATTTCGATATCCAAGGCGGGTATCAATACAACTTTGAACGCCAGAACCTCAATCTT  627462
               ||||||||||||||||||||||| ||||||||||| |  |  ||||||||||||||||||
Old    627398  AACAATTTCGATATCCAAGGCGGTTATCAATACAAATCCGGGCGCCAGAACCTCAATCTT  627457

New    627463  AGCGGCAGCAAATCCGTTGTATGGTAGATATAATCCTAGATTATCACCTCTGGACAATAT  627522
               ||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||
Old    627458  AGCGGCAGCAAATCCGTTGTATGGTAGAATTAATCCTAGATTATCACCTCTGGACAATAT  627517
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
2011-02-03A single nucleotide insertion and a single nucleotide substitution were made in the intergenic region between ORFs YBR201C-A and MCM7/YBR202W.
New    625423  ATTTTCTCAATAACAGGTCGAGGCCCCTTCTACCCTTGAATGCTACTTATTACTCACTCA  625482
               ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Old    625419  ATTTTCTCAATAACAGG-CGAGGCCCCTTCTACCCTTGAATGCTACTTATTACTCACTCA  625477
New    625483  TAATACATTGTATAAGCCTTCGCGTTTTTCACGGCCTCGAAAAAATTTTTCTTAACTAAT  625542
               |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Old    625478  TAATACATTGTATAAGCCTTCGTGTTTTTCACGGCCTCGAAAAAATTTTTCTTAACTAAT  625537
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
Mapping Notes
DateNote
1997-10-20Edition 14: member of the MCM/P1-family of genes which play a role in the licensing of DNA replication; others members of this family include : MCM2, MCM3, MCM4 (CDC54), MCM5 (CDC46), and MCM6

Cherry JM, et al.  (1997) Genetic and physical maps of Saccharomyces cerevisiae. Nature 387(6632 Suppl):67-73