DER1/YBR201W Locus History Help


Nomenclature History
Standard Name Reference
DER1 Knop M, et al.  (1996) Der1, a novel protein specifically required for endoplasmic reticulum degradation in yeast. EMBO J 15(4):753-63
Sequence Annotation Notes
DateNote
1999-04-26A change was made to the systematic sequence of Chromosome II in the region upstream of the ORF DER1/YBR201W. The A at chromosomal coordinate 623651 was deleted. As a result, the start of YBR201W was moved upstream 210 nucleotides, increasing the size of the predicted protein from 141 to 211 amino acids.
Old: 623640 GATCCAGGGAAAGGTAGTGTACAGTTATGATTTAGTATTCAAAAAGGGACAATATGGAAG 623699
            ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
New: 623640 GATCCAGGGAA-GGTAGTGTACAGTTATGATTTAGTATTCAAAAAGGGACAATATGGAAG 623698
2011-02-03A single nucleotide deletion was made in the intergenic region between ORFs YBR200W-A and DER1/YBR201W.
New    623434  GAAGGTATAACAAAA-CAGATAGACACCTAATAAAGAACAAAATATTCCTATAGTTTTGC  623492
               ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Old    623429  GAAGGTATAACAAAACCAGATAGACACCTAATAAAGAACAAAATATTCCTATAGTTTTGC  623488
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
Mapping Notes
DateNote
1998-11-10Edition 15: Nucleotide 115, an A, has been removed, altering translation by shifting the reading frame; this ORF is now 211 amino acids long.

Cherry JM, et al.  (1998) "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 15)". Pp. 414-420 in 1998 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America