CDC28/YBR160W Locus History Help


Nomenclature History
Standard Name Reference
CDC28 Nasmyth KA and Reed SI  (1980) Isolation of genes by complementation in yeast: molecular cloning of a cell-cycle gene. Proc Natl Acad Sci U S A 77(4):2119-23 Hartwell LH, et al.  (1973) Genetic Control of the Cell Division Cycle in Yeast: V. Genetic Analysis of cdc Mutants. Genetics 74(2):267-286
Nomenclature History Notes
DateNote
2003-12-09CDC28/YBR160W encodes the catalytic subunit of the main cyclin-dependent protein kinase, which is the pombe Cdc2 ortholog. Do not confuse CDC28 with the cerevisiae POL3/YDL102W gene (originally named CDC2), which encodes a subunit of DNA polymerase III.
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide deletion was made in the intergenic region between ORFs CDC28/YBR160W and CSH1/YBR161W.
New    561405  GCAAATTCATTGCTCTTTGAATTTTGAAGAGTTTCA-TTGTCACCGTTGAATAACCGAGA  561463
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Old    561399  GCAAATTCATTGCTCTTTGAATTTTGAAGAGTTTCACTTGTCACCGTTGAATAACCGAGA  561458
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
Mapping Notes
DateNote
1992-10-01Edition 11: srm5 is allelic to cdc28

Mortimer RK, et al.  (1992) Genetic and physical maps of Saccharomyces cerevisiae, Edition 11. Yeast 8(10):817-902
1998-11-10Edition 15: This gene is a homolog of the pombe CDC2 gene; do not confuse this gene (CDC28/YBR160W) with CDC2/YDL102W, which is the catalytic subunit of DNA polymerase III.

Cherry JM, et al.  (1998) "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 15)". Pp. 414-420 in 1998 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America