VPS15/YBR097W Locus History Help


Nomenclature History
Standard Name Reference
VPS15 Robinson JS, et al.  (1988) Protein sorting in Saccharomyces cerevisiae: isolation of mutants defective in the delivery and processing of multiple vacuolar hydrolases. Mol Cell Biol 8(11):4936-48 Rothman JH, et al.  (1989) Characterization of genes required for protein sorting and vacuolar function in the yeast Saccharomyces cerevisiae. EMBO J 8(7):2057-65
Other Name(s)Reference
VPL19 Rothman JH, et al.  (1989) Characterization of genes required for protein sorting and vacuolar function in the yeast Saccharomyces cerevisiae. EMBO J 8(7):2057-65
VPS40 Raymond CK, et al.  (1992) Morphological classification of the yeast vacuolar protein sorting mutants: evidence for a prevacuolar compartment in class E vps mutants. Mol Biol Cell 3(12):1389-402
VPT15 Seeley ES, et al.  (2002) Genomic analysis of homotypic vacuole fusion. Mol Biol Cell 13(3):782-94
Nomenclature History Notes
DateNote
2014-04-03The VPT15 genetic locus was previously a "Not Physically Mapped" feature in SGD. However, PMID: 11907261 states that VPT15 is allelic to VPS15. VPT15 was merged with VPT15 in April 2014.

Seeley ES, et al.  (2002) Genomic analysis of homotypic vacuole fusion. Mol Biol Cell 13(3):782-94
Sequence Annotation Notes
DateNote
2011-02-03Nucleotide change(s) in the coding region of VPS15/YBR097W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 134 is now Alanine rather than Threonine, and residue 851 is now Arginine rather than Isoleucine.
New    437325  ATTCATTGCTTTCCAGTTGTTAAATGCATTAAAGGACATTCATAATCTGAATATTGTCCA  437384
               ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Old    437319  ATTCATTGCTTTCCAGTTGTTAAATACATTAAAGGACATTCATAATCTGAATATTGTCCA  437378

New    439485  CTTAACTGCTGAAGACAGAAATTGGATTGATAAGTTCCACATTATTGGGCTAACAGAAAA  439544
               ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Old    439479  CTTAACTGCTGAAGACATAAATTGGATTGATAAGTTCCACATTATTGGGCTAACAGAAAA  439538
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()