IST2/YBR086C Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2001-02-15.
Standard Name Reference
IST2 Entian KD, et al.  (1999) Functional analysis of 150 deletion mutants in Saccharomyces cerevisiae by a systematic approach. Mol Gen Genet 262(4-5):683-702
Sequence Annotation Notes
DateNote
2003-01-02We received a direct notification from MIPS about the following sequence changes; we did not have this change in SGD, so the sequence was edited: The T at 422272 was changed to an A, and the A at 422273 was changed to a T. These differences changed amino acid residue 243 of IST2/YBR086C from Tyr (TAC) -> Ile (ATC). The coordinates of YBR086C are not changed due to this sequence update. References: (1) Sequence verification in FY1679 (S288c derivative strain) background by SGD, (2) Personal communication from Anna Kurlandzka (ania218@poczta.ibb.waw.pl).
Old: 422221 GTAGGCAAAAAAGACAAGATGGAAATCATTGGGCCGTTATAAATTTGCTTGTAGAAAATT 422280
            |||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||
New: 422221 GTAGGCAAAAAAGACAAGATGGAAATCATTGGGCCGTTATAAATTTGCTTGATGAAAATT 422280